a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene…
a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide
"You need a similar assignment done from scratch? Our qualified writers will help you with a guaranteed AI-free & plagiarism-free A+ quality paper, Confidentiality, Timely delivery & Livechat/phone Support.
Discount Code: CIPD30
Click ORDER NOW..


