1 . Given the DNA sequence 5’GTCGTACGATGCCATTA C

1 . Given the DNA sequence 5’GTCGTACGATGCCATTA C

1. Given the DNA sequence
5’GTCGTACGATGCCATTACGAGGTGAGGCTGTTAGCTGATGGTGTTAT3′
3’CAGCATGCTACGGTAATGCTCCACTCCGACAATCGACTACCACAATA5′
What would the mRNA sequence be?
5′ CAG-CAU-
The amino acid sequence?
If the indicated base pair (C:G) is changed to a (T:A) due to a mutation, what would happen to the amino acid sequence?
What type of mutation is this?
Do you think the protein would be functional? Why or why not?
2. What would happen in each of the following situations:
-If a researcher moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene.
-If a researcher moves the operator to the far end of the operon, past the transacetylase (lacA) gene
-If a researcher moves the repressor gene (lacI), along with its promoter, to a position several thousand base pairs away from its normal position.

"You need a similar assignment done from scratch? Our qualified writers will help you with a guaranteed AI-free & plagiarism-free A+ quality paper, Confidentiality, Timely delivery & Livechat/phone Support.


Discount Code: CIPD30



Click ORDER NOW..

order custom paper