Need biology help to Make a worksheet about Protein
Need biology help to Make a worksheet about Protein
Show the steps taken by an eukaryotic cell to make a protein. Below is a section of the non-template strand of the DNA containing the gene that codes for our desired protein.
NT: ATAATGCGCATTGGACACACTTGA
1. Write the complementary template strand
2. Transcribe the DNA to RNA using the template strand
3. Where in the cell would transcription take place?
4. If the RNA produced is mRNA, where in the cell does it go next?
5. To what organelle does it connect with there?
6. Translate the mRNA you obtained in #2 into proteins using the genetic code table shown below.
7. What are proteins consisted of?
"You need a similar assignment done from scratch? Our qualified writers will help you with a guaranteed AI-free & plagiarism-free A+ quality paper, Confidentiality, Timely delivery & Livechat/phone Support.
Discount Code: CIPD30
Click ORDER NOW..


